The Reporter Vector (RV) Sequencing Primers are designed for sequencing inserts in the pGL3, pGL4, Chroma-Luc and pCAT3 Reporter Vectors.

The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc Vectors and pCAT3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used for sequencing double-stranded templates, but only RVprimer4 can be used for sequencing single-stranded templates. Primer Sequences: RVprimer3, 5'-d(CTAGCAAAATAGGCTGTCCC)-3'; RVprimer4, 5'-d(GACGATAGTCATGCCCCGCG)-3'.